
سوال: کاهش مرتبه اجرایی

سلام من یک برنامه خیلی ساده دارم که مرتبه اجراییش O(mn) هست چون ...

موضوع سوال: کاهش مرتبه اجرایی,.

برنامه نویس, برنامه نویسی, برنامه نویسی با زبان C و ++C

تاريخ ارسال:2014/07/21

هاست سنتر سلام من یک برنامه خیلی ساده دارم که مرتبه اجراییش O(mn) هست چون تابع استفاده شده دو حلقه وابسته داره ولی باید مرتبه اجراییش رو به مرتبه خطی O(n) برسونم میشه لطفا کمکم کنید #include <iostream.h> #include<stdlib.h> int *char_count( const char* DNA, const int *starts, const int *ends, char letter); int main() { char string[40]="ACGAAAAGGGTGCGCCGGGGACTGGGGGTAT"; const int enda[6]={3,10,13,16,20,23}; const int starta[6]={1,2,9,12,15,18} ; int *counta=new int [6]; cout<<"number of occurrance of nucelotid in each interval is: \n"; counta= char_count(string,starta,enda,'G') ; for(int m=0 ;m<=5;m++) cout<<counta[m]<<"\t"; delete [] counta; getch(); return 0; } //****************** int *char_count( const char* DNA, const int *starts, const int *ends, char letter) { int *count=new int [6]; for(int l=0;l<=5;l++) { count[l]=0; for (int i=starts[l];i<= ends[l]; i++) if(DNA[i] == letter) count[l] ++ ; } return count; } هاست,دامین,سایت,وب,طراحی

سوال:, کاهش, مرتبه, اجرایی

سوال: کاهش مرتبه اجرایی

میزبانی وب ,هاست,فضای وب,ویندوز,لینوکس,دات نت,پی اچ پی,web hosting,windows host,linux host,,php,sql server,mysql میزبان پایتخت ارائه دهنده خدمات میزبانی وب، هاست و هاستینگ، میزبانی هاست، دامین، میزبانی نمایندگی، نمایندگی وب، سرور مجازی و سرور مجازی ابری می باشد.هاست,میزبانی وب,دامین,سرور مجازی,میزبان پایتخت,host,domain,vps,mizban paytakht,hosting,share hosting,میزبان وب,میزبانی هاست,هاستینگ
